Egalité et Réconciliation
https://www.egaliteetreconciliation.fr/
 

Covid-19 – Preuves de fraude mondiale

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID-19.

 

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SARS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SARS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

 

 

Identification de quoi exactement ?

L’Organisation mondiale de la santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SARS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SARS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov. Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques. »

Ces deux déclarations de l’OMS suggèrent clairement que le virus SARS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

 

 

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SARS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SARS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SARS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SARS-CoV-2. »

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SARS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

 

 

Voyage de Discovery

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le premier génome complet du SARS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SARS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1 % avec le coronavirus du SARS (SARS-CoV). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6 % au SARS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SARS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SARS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome respiratoire aigu sévère (SRAS, ou SARS en anglais). Ils ont prélevé des échantillons sur deux de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57 % de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SARS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SARS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie. »

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SARS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57 % à un coronavirus prétendument connu. Les 43 % restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6 % avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

 

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SARS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’institut Doherty ont annoncé qu’ils avaient isolé le virus SARS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic. »

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles. »

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la liberté d’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SARS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande. »

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande. »

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SARS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

 

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SARS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SARS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SARS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

- Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SARS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
- Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SARS-CoV-2 qui est censé faciliter la liaison du SARS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
- Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
- Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SARS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SARS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SARS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SARS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SARS-CoV-2 avec une identité de séquence correspondant à 100 %. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SARS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100 %. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100 % avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100 % au gène E du SARS-CoV-2 et 100 microbes avec une identité de séquence de 100 % au gène vital RdRp du SARS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SARS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SARS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SARS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela : « Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus ».

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SARS-CoV-2. 9 % des cas étaient positifs pour trois gènes, 18 % pour deux gènes et 73 % pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SARS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SARS-CoV-2. »

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SARS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SARS-CoV-2 est censé être hautement spécifique au génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100 %. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95 %. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100 % avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SARS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SARS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SARS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

 

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre. »

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel. »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une entreprise criminelle commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Ccode Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

 


 

Bonus : Astrid Stuckelberger – comprendre la gestion de la pandémie

Hold-up sur des mal traités, sur E&R :

 



Article ancien.
Les commentaires sont désactivés



Alerter

111 Commentaires

AVERTISSEMENT !

Eu égard au climat délétère actuel, nous ne validerons plus aucun commentaire ne respectant pas de manière stricte la charte E&R :

- Aucun message à caractère raciste ou contrevenant à la loi
- Aucun appel à la violence ou à la haine, ni d'insultes
- Commentaire rédigé en bon français et sans fautes d'orthographe

Quoi qu'il advienne, les modérateurs n'auront en aucune manière à justifier leurs décisions.

Tous les commentaires appartiennent à leurs auteurs respectifs et ne sauraient engager la responsabilité de l'association Egalité & Réconciliation ou ses représentants.

  • #2628436
    le 28/12/2020 par Système
    Covid-19 – Preuves de fraude mondiale

    Dans mon entourage, 99% des gens ont gobé la propagande gouvernementale ! Alors la révolte des nations, ce n’est pas pour demain.,,

     

    • #2628611
      le 29/12/2020 par LeDen
      Covid-19 – Preuves de fraude mondiale

      Non seulement ils ont tous gobé le mensonge mais en plus ils se font les agents de la réinformation, dans une lâcheté incroyable, en traitant de complotiste et de malade ceux qui ont les yeux ouverts.
      C’est le principe du doux mensonge opposé à la dure vérité.


    • #2628713

      @Système

      99% de ces gens-là sont rongés par la fainéantise intellectuelle,l’ignorance .Ils ne vont pas chercher plus loin et gobe tout ce qu’ils entendent sans même essayer de les voir ou tout au moins à comprendre en cherchant des explications cohérentes .


    • #2628719
      le 29/12/2020 par Henri
      Covid-19 – Preuves de fraude mondiale

      Nos frontières restant ouvertes, la France continue à voir arriver des migrants venus de partout : ils apportent avec eux leur maladies et leurs virus qui ne sont pas tous connus . On peut s’attendre à l’apparition de nouvelles - et cette fois réelles - épidémies . Certains sites annoncent l’arrivée d’une nouvelle blennorragie particulièrement résistante aux antibiotiques . " On ne va tout de même pas demander leur carnet de santé aux pauvres Afghans à demi sauvages ! "


    • #2628776

      Vous êtes défaitiste, de mon côté c’est loin d être le cas, les hommes ne sont pas castrés et les femmes veulent protéger leur progéniture de cette piquouse OGM. 60% du personnel médical ne se fera pas vacciner. Et 60% des français ne le veulent pas non plus. Certes ce chiffre va baisser mais il y a au moins un bon tiers qui ne reviendra jamais sur sa décision même sous la torture, dur de marginaliser autant de monde... Et leur passeport vaccinal c’est une utopie sataniste, tant qu on y est ils n ont qu a nous mettre un pyjama rayé et nous enfermer dans des camps.


    • #2629208
      le 29/12/2020 par De Bonald
      Covid-19 – Preuves de fraude mondiale

      Je propose un coronavirus jaune cousu sur notre veste si on n’est pas vacciné. Qui vote pour ?


  • #2628450
    le 28/12/2020 par Cathelino
    Covid-19 – Preuves de fraude mondiale

    Pendant ce temps là Adolf Barbier et toute la clique de sociopathes dégénérés continuent à pratiquer l entre soi sur les plateaux télé menaçant d exclusion sociale les non vaccinés. Il n y a aucun débat, la pensée unique mondialiste en action, dictature totale !

     

    • #2628799

      @cathelino
      Je pensais que son prénom était Joseph...


    • #2628882
      le 29/12/2020 par Pouet
      Covid-19 – Preuves de fraude mondiale

      Mais non !

      C’est Klaus Barbier !


    • #2629194
      le 29/12/2020 par Snayche
      Covid-19 – Preuves de fraude mondiale

      Ouais, en plus impressionnant les fréquents petits commentaires de l’animateur cherchant à orienter le plateau, les esprits, les âmes, le peuple en masse !
      J’en rigole fort tellement c’est honteusement sournois et affichés en même temps !
      Ca c’est sûr, ils l’emporteront pas au Paradis.
      La prophétie annonçant que les démons seront visibles à la fin des temps m’apparait de plus en plus comme finalement bien réelle à notre époque.
      Et dire que les insouciants les respectent, leur font confiance voire les aiment, alors qu’ils les poussent en douceur tels des aveugles vers un abime de feu...


  • #2628465
    le 28/12/2020 par Sermanu
    Covid-19 – Preuves de fraude mondiale

    Pandemie le 11 mars 2020 plutôt ?


  • #2628466
    le 28/12/2020 par anonyme
    Covid-19 – Preuves de fraude mondiale

    Vous m’excuserez mais cela fait depuis un temps maintenant qu’on devrait être censé savoir qu’il s’agit d’une mascarade. Donc plus besoin de toutes ces preuves et autres grandes démonstrations pour corroborer ou mettre en exergue quelconque contradiction. C’est continuer à donner du vent au narratif comme si il pouvait y avoir encore le moindre doute. L’incroyable c’est que il y a encore des imbéciles, même parmi des gens sur ce site, qui accordent le moindre crédit à ce virus fantôme en dépit du fait qu’on ne cesse de répéter que seulement 0,05 de gens en clamse et souvent des gens en fin de vie et souffrant déjà d’autres pathologies. Pour moi, il s’agit de la plus grande mascarade de tous les temps ; elle éclipse même les images de ce clown marchant sur la lune. Même si je n’exclus qu y ait bien pu avoir ultérieurement des contacts avec des extra terrestres dont on ignore tout.

     

    • #2628653

      En lisant le magazine top secret et Roch Sauquere, j’ai compris que les mensonges sont récurrents dans l’histoire dans tous les domaines depuis bien longtemps.

      Certains ont compris qu’ils pouvaient tirer profits des gentils qu’ils maintiennent dans l’ignorance et en les faisant se battre les uns contre les autres.

      Mais ! Tous ceux qui le souhaitent ont les moyens techniques pour soulever le voile de l’ignorance. Combien sont prêts à faire cet effort ? Ça dépendra du degré d’inconfort ressenti.

      Reconnaissez à vos interlocuteurs l’appréhension lorsqu’on est exposé à l’inconnu, argumentez ensuite par petites doses.


    • #2628792
      le 29/12/2020 par anonyme
      Covid-19 – Preuves de fraude mondiale

      ""le magazine top secret et Roch Sauquere"

      Dis donc tu en as des références ! Sauquere ce malade qui prétend que les pyramides auraient été construits par des Français et qu’elles dateraient du moyen-âge ! Que les dinosaures et n’auraient pas existé et autres insanités ! Ce type sa place est dans un asile.


    • #2630325
      le 31/12/2020 par Paul82
      Covid-19 – Preuves de fraude mondiale

      Mais bien sur que si, cher @anonyme, il faut des preuves, des démonstrations.... La science, la vraie, n’a rien à voir avec la magie, et ca ne se fait pas à coup de décrets ! On ne peut pas affirmer sur la place publique (ni entre copains) que le virus covid19 n’existe pas sans apporter des éléments qui appuient cela. Autrement on passe pour un gentil dinguo, à isoler ou à enfermer selon le lieu. C’est pourtant clair non ?

      Quant au reste, je me suis déjà exprimé.


  • #2628467
    le 28/12/2020 par René F.
    Covid-19 – Preuves de fraude mondiale

    Les test fonctionne comme le ferait la recherche d’une phrase-clé dans un gros livre. Or cette phrase-clé peut être commune à plusieurs livres. Ainsi l’absence de grippe en 2019 pourrait s’expliquer parce qu’elle aurait été étiquetée comme étant le SARS-CoV2.


  • #2628471
    le 28/12/2020 par Orlando
    Covid-19 – Preuves de fraude mondiale

    Donc Raoult est un menteur ?

     

    • #2628617
      le 29/12/2020 par René F.
      Covid-19 – Preuves de fraude mondiale

      L’article peut sembler entrer en contradiction avec ce que dit l’IHU dirigé par Didier Raoult.

      D’un côté, on n’a pas identifié clairement le, ou les, virus de la Covid-19, mais de l’autre côté on a quelques séquences génomiques complètes faites par l’Institut Pasteur, plusieurs dizaines faites par les généticiens de Marseille, et plusieurs centaines au Royaume Uni parait-il.

      L’article est subtile, car il ne critique pas le travail des généticiens.

      L’article dénonce principalement le manque de fiabilité des tests PCR et antigéniques, car ils se basent sur des séquences incertaines. Même Raoult le reconnait, quand il dit que l’IHU utilise des séquences qui ont été établies en interne, et que d’autres établissements en utilisent d’autres, dont il sous-entend qu’elles sont moins pertinentes.

      L’article émet aussi des doutes sur l’association entre les séquences complètes trouvées et la maladie Covid-19 vécue par la population. En clair, l’article pense que l’étiquette Covid-19 est apposée non seulement aux nouveaux coronavirus séquencés, mais aussi aux virus de la grippe et des rhumes, dans de nombreux cas. Ca me parait vrai, mais je n’ai pas entendu Raoult en parler.


    • #2628643

      C’est une des questions collatérales...


    • #2628683
      le 29/12/2020 par Frédéric
      Covid-19 – Preuves de fraude mondiale

      J’ai eu la même réflexion. Le professeur Raoult nous présente régulièrement les résultats des recherches effectuées par son service et il parle de variants ( variants d’un virus donc ).
      D’autres parts, on ne peut pas nier l’existence de symptômes spécifiques (pertes de goût et d’odorat, infection des voies respiratoires). Il ne s’agit pas d’une grippe classique.
      Je suis allé consulter l’article original de Iain Davis sur le site https://off-guardian.org/2020/11/17..., et l’excitation étant passée, j’ai l’impression qu’il s’agit du plus convaincant des articles d’intoxication.


    • #2628702

      Pour moi, humble citoyen, vous pointez là le GROS problème.
      La plupart des gens sur ce site se gaussent des crédules.
      Les gens qui croient en ces bobards.
      Mais comme le fait très justement remarquer Orlando l’article contre-dit les savants qui sont rejetés par le NOM et qui sont traités de complotiste dont Raoult et Montagnier.
      Qui a raison alors ?
      Virus / Pas virus.
      Séquençage / Pas séquençage.
      Si séquençage, lequel ?
      Il faudrait lire les articles de Raoult pour en savoir plus.
      C’est sur cela que l’on devrait l’interviewer et plus sur sa chloroquine.
      Histoire de juste comprendre si arnaque il y a, QUI ARNAQUE QUI ?


    • #2628716
      le 29/12/2020 par Atlante
      Covid-19 – Preuves de fraude mondiale

      Il faudrait envoyer ça à Raoult et Fouché pour qu’ils nous fassent une explication de texte.
      J’ai compris dans l’ensemble ce qui est écrit ici, mais cela me semble être un article excessif qui ne va pas dans le sens de la Vérité. Seule la partie sur les tests PCR est vraiment intéressante mais la première partie ne prend pas assez de précautions car il faut être aveugle pour ne pas avoir suivi qu’il y avait à la fois un ou des virus qui circulent qui font parfois quand même des dégâts sur nos ainés et personnes fragiles et qu’EN MEME TEMPS il y avait une énorme instrumentalisation politico-médiatico-scientifique avec les tests bidons, la peur disproportionnée et l’ingénierie sociale de la mise en esclavage. On a le droit d’être subtile et de reconnaitre qu’il y a un virus et des mutations ou plusieurs virus mais que ceux ci sont bien moins dangereux que TOUTE la propagande médiatique qui constitue la réelle pandémie par contruction d’un naratif de la peur et de la soumission. Leur virus chimère a merdé, il était pas assez virulent, ils en ont fait des tonnes pour "aider" le virus à faire des dégâts en sabotant la chaine de soins. Le problème c’est que tout est visible et qu’on a les noms...


    • #2629189

      C’est exactement ce que je me suis dit quand j’ai lu l’article. Il faudrait demander à Raoult ou Fouché ce qu’ils en pensent.

      A priori je dirais : il se peut qu’il existe un virus et il est quasiment certain que les chiffres du COVID 19 sont faux. on lui attribue tous les gens malades et tous les morts pour être caricatural.

      C’est comme le VIH, il existe un virus, mais les tests de séro-positivité sont sensibles à autre chose. c’est la même ingénierie de crise. celle du VIH a certainement servi de galop d’essai.

      Le bémol que je mettrais est qu’il est également possible que l’article soit fait par le système pour décrédibiliser les médecins comme Raoult, en laissant planer l’idée qu’ils auraient également participer au mensonge de l’existence du virus ... ça serait bien vu effectivement ... à bon entendeur.


    • #2630301
      le 31/12/2020 par nicolaslardechois
      Covid-19 – Preuves de fraude mondiale

      @ Atlante , tu résumes exactement ce que je n’arrive pas à expliquer de manière synthétique ! Bref, Merci !


  • #2628473
    le 28/12/2020 par goy pride
    Covid-19 – Preuves de fraude mondiale

    J’ai toujours eu l’intuition que ce virus n’existait même pas mais afin de ne pas traumatiser mon auditoire en tenant des propos excessivement négationnistes et complotistes j’ai fait le choix de la narration plus facile à faire accepter suivante : "Bien sur qu’il y a un virus, c’est juste que les réactions gouvernementales et décisions sont excessives..." Mais en réalité j’ai d’énormes doutes.

    Il est effectivement fort possible qu’il n’y ait même pas de pandémie du tout. Certains rétorquerons à raison qu’il y a bien des malades, qu’une trentaine de médecins en France sont (seraient ?) décédés du Covid...certes, mais rien n’indique qu’ils sont morts du covid plutôt que d’une infection respiratoire banale. J’ai moi même eu mon médecin de famille fraîchement diplômé d’une trentaine d’années qui s’était effondré dans son cabinet médical et n’a pas pu être réanimé par son collègue qui était sur place, médecin aguerri d’une cinquantaine d’années, qui l’avait pourtant immédiatement pris en charge (4 décennies sont passées depuis mais en y repassant cela me fait un pincement au cœur !) Et vous savez il est mort de quoi ? Une grippe mal soignée dans un contexte de surmenage ! Ce médecin était asthmatique, avait choppé une grippe...ne s’était pas arrêté de travailler, avalait de cachetons pour camoufler les symptômes...Des gens dans certains contexte peuvent mourir d’une infection respiratoire ! C’est rare quand cela touche des individus jeunes mais cela arrive ; organisme fatigué suite à un surmenage, choc émotionnel violent (décès d’un proche), comorbidité...et les choses peuvent prendre un tournant dramatique et inattendu. Donc dans des populations de plusieurs dizaines de millions d’habitants on trouvera toujours des gens qui attraperont une saloperie, et parmi eux certains en mourront, majoritairement des personnes en fin de vie mais pas que ! Donc il suffit de décréter qu’il s’agit d’un covid et le tour est joué.

     

    • #2628589
      le 29/12/2020 par Lérins
      Covid-19 – Preuves de fraude mondiale

      C’est marrant, c’est un peu comme les avions sur les Twin Towers, le 11/9/2001 : ont-ils réellement percuté les tours ? Aucune boite noire ! Quasiment aucun débris d’aéronef ! Un film qui montre à un milliard de téléspectateurs, le "nez" de l’un d’entre eux, qui ressort intact de l’autre côté du building blindé d’acier, comme dans les dessins animés (dont le réalisateur était d’ailleurs un pro.)...


  • #2628480
    le 28/12/2020 par LaKovid NoPoche
    Covid-19 – Preuves de fraude mondiale

    Le texte et le bonus sont incroyables. L’ampleur du mensonge n’a pas de précédent. Tout ça pour enclencher la grande réinitialisation et aboutir au NOM. Les ordures qui sont aux manettes piétinent tout sur leur passage, sans état d’âme et avec une effroyable détermination. Ce sont des fous dangereux qu’ils faut mettre hors d’état de nuire de toute urgence. Quels sont nos moyens immédiats ?


  • #2628482
    le 28/12/2020 par pleinouest35
    Covid-19 – Preuves de fraude mondiale

    Bon, l’armée, si la France a encore une armée, elle intervient quand pour neutraliser tous ces salauds ?

     

    • #2631211
      le 01/01/2021 par Melimela
      Covid-19 – Preuves de fraude mondiale

      Oui, le temps passe, et il ne se passe pas grand chose.... à moins que ? l’action demande peut-être de la discrétion ? mais le temps presse !!!!! On n’arrive déjà pas à obtenir de la cohésion, de la coordination dans un pays, alors au niveau mondial, cela relève du numéro de trapèze sans filet, une gageure. Et pendant ce temps-là en face, ils peaufinent leur funeste projet, cela fait tellement longtemps qu’ils attendent ce moment ! D’autant plus qu’ils ont une longueur d’avance avec l’effet de surprise, et qu’il reste encore tellement d’autruches qui doivent absolument sortir le cou du sable !!!!!
      Qu’est-ce qu’on a bien pu faire au Bon Dieu .....


  • #2628486
    le 28/12/2020 par Mikael
    Covid-19 – Preuves de fraude mondiale

    Je trouve bizarre qu’aucun journalistes et toubibs des chaines en continues ne demandent aux laboratoires d’isoler ce virus pour savoir comment le combattre , et aussi une enquête pour suivre le cheminement de ce virus et comment il est sorti du laboratoire P4 hyper sécurisé ,là ou sont stockés les virus les plus virulents !!En 2017 Le Driant le ministre de Hollande est parti à Huwan pour inaugurer le bâtiment P4 flambant neuf d’ou est sorti cette saloperie, !En 2009 déjà,Mr le pantalon à une jambe nous disait que pour réaliser le NOM rien de mieux qu’une épidémie mondiale qui infecterait le maximum de populations !


  • #2628489
    le 28/12/2020 par JP-Groove
    Covid-19 – Preuves de fraude mondiale

    Les russes revoient leur copie en avouant 3 fois plus de morts du Covid qu’initialement déclaré. L’information proviendrait de "certains experts", puis confirmé par l’agence statistique Rosstat, qui justifierait un reconfinement comme ils le prévoient chez nous. Qu’en pense Xavier Moreau ?
    Perso je trouve ça gros de trouver une surmortalité de 230K personnes quelques jours avant la nouvelle année, et d’en attribuer la cause au Covid à 81% d’entre elles. Veulent-ils faire le jeu des mondialistes en prévision du Great Reset ? Au tout début les russes ont pris le Covid très au sérieux, puis ils ont soigné efficacement avec les médicaments adéquats. Pourquoi ce revirement soudain ?


  • #2628493
    le 28/12/2020 par Jérômeproudhon
    Covid-19 – Preuves de fraude mondiale

    Bah voilà, l’information peut créé des histoires pour le peuple ( comme elle l’a toujours faite ) ,et même à la fin de l’année, quand nous allons parler de mortalité avec 20 ou trente milles morts de plus que 2019 ,il y avait déjà 30 milles morts de plus de 2011 a 2012 ou 40 milles de plus de 2014 à 2015 . Absolument tout devient un narratif, l’écran raconte, le peuple regarde l’écran, et dans pas longtemps, c’est le tout petit écran espion qui racontera une seule narrative. Oui ,c’est une opération, un plan, covid 19 ,plus beau, plus fort ,plus grand que les guerres mondiales, que les révolutions, qu’Hitler. Et C’est pas fini ! La phase 2 de la narration pour les inutiles ( après le contrôle plus strict de la toile ) ,j’espère va enfin réveiller les guerriers, les croyants, les soldats de la réalité, le courage, l’honneur, le sacrifice.


  • #2628509

    Au moment ou le tableau périodique des éléments de Mendeleïev a été dessiné il n’y avait pas de microscope à balayage électronique.
    De plus les images de virus qu’on voit est une interprétation de la réalité,c’est une image virtuel.
    La question est :les virus existe vraiment ?Ou est ce juste une interprétation d’autre chose ?

    Est ce que cette interprétation est vivante ?
    Si elle transmet elle même son patrimoine génétique ,il lui faut donc de l’énergie ,elle possède donc une source d’énergie indépendante donc elle est vivante.
    Extrapolons voulez vous : la lave comparé à l’écorce terrestre elle est chaude ,il y a donc une différence de température il y a donc de l’énergie :Ou est donc la source d’énergie ?

     

    • #2628633

      Qui a déjà observé hors d’une matière organique un virus ?
      Je ne crois pas aux dit virus qui se balladeraient dans l’air.
      La maladie est un processus qui ne vient pas de l’extérieur mais de l’intérieur d’un humain, c’est lui-même qui engendre sa propre maladie qu’elle qu’elle soit, en réponse à la peur, aux frustrations répétées, et aux déséquilibres psycho-émotionels de la vie des gens : MALADIE = LE MAL A DIT...


    • #2628674
      le 29/12/2020 par Thorgal83
      Covid-19 – Preuves de fraude mondiale

      Et c’est aussi la méthode utilisé pour l’infiniment grand, regardez les "images" de planètes , ou plus loin encore , elles sont toutes des interprétations artistique de graphistes de la Nasa. Avec le plus gros télescope terrestre ,Mars ressemble à une cellule humaine ,une amibe..au choix, alors la narration de ces observateurs du monde ,Galilée, Coppenicus, Newton et leurs lentilles qui grossissent 14X...désolé mais j’ai basculé depuis longtemps, et je ne crois même plus à la réalité de notre terre telle qu’elle imposée, Big bang..Dinosaures..Extinction..Darwinisme..Voyage sur la lune..et mon cul sur la commode,, j’en ai volontairement oublié dans mon raccourci la liste est trop longue


    • #2629337
      le 29/12/2020 par Snayche
      Covid-19 – Preuves de fraude mondiale

      @Thorgal83
      Ta propre création ayant de l’intelligence et l’univers intelligemment organisé puisque lui permettant de vivre prouvent une intelligence à leur origine qu’on appelle Dieu : crois au moins en ça et déduit le reste, y a suffisamment de preuve sur terre. Commence par Son dernier livres révélé pour t’aider...


  • #2628513
    le 29/12/2020 par becalme
    Covid-19 – Preuves de fraude mondiale

    Un tribunal à EL QODS bientôt libérée , pour juger ces criminels.
    J’aimerais bien que le professeur Didier Raoult nous disent quelques choses la dessus.

     

    • #2628627
      le 29/12/2020 par veritas
      Covid-19 – Preuves de fraude mondiale

      C’est quoi un tribunal libéré ?


    • #2628913
      le 29/12/2020 par Désinfectant
      Covid-19 – Preuves de fraude mondiale

      @veritas

      Il parle d’Al Qods (Jérusalem) libérée de l’entité sioniste, et effectivement il serait temps que Raoult / l’IHU de Marseille et autres spécialistes sérieux commencent à communiquer clairement sur ce qui se passe, nous sommes à un tournant et il n’y aura pas de retour en arrière. Si effectivement il n’y a pas de preuves d’épidémie de SARS-CoV-2 comme dit l’article et qu’ils continuent de faire semblant sous pretexte qu’ils ne font "pas de politique" et ne veulent pas entrer dans les polémiques alors, vu les enjeux, c’est tout bonnement des lâches voire des complices.


  • #2628514
    le 29/12/2020 par 3245vg234v53
    Covid-19 – Preuves de fraude mondiale

    ce qui serait bien maintenant, ca serait de sequencer la partie arn des soit-disant vaccins, parce cette histoire de molecule spike ca fait peur, ca serait pas la premiere fois non plus qu’un pouvoir sterilise par le vaccin, enfin bon je dis ca je dis rien...


  • #2628534

    Cette affaire du covid-19 illustre la primauté de la force sur tout autre qualité pour assumer le pouvoir.

    Une preuve n’est valable que si elle est acceptée de bonne foi, or ceux-là mêmes qui évaluent la preuve (politiques, médecins, juges, forces de l’ordre, média, etc.) refusent précisément de voir quelque preuve que ce soit, et quand bien même daigneraient-ils s’y pencher qu’ils la balayeraient d’un revers de manchette, ivres de leur puissance et galvanisés par le cynisme de leur mauvaise foi.

    Avec un autre rapport de force, ils auraient une toute autre attitude. Pour l’instant, ce sont eux qui tiennent le manche, et ils ne le lâcheront jamais de bon gré. Jamais.

     

    • #2628701
      le 29/12/2020 par HNNNNNG
      Covid-19 – Preuves de fraude mondiale

      Pas si sûr. Les différentes composantes du pouvoir que vous avez énumérées témoignent justement de son organisation en strates - strates dont les degrés d’implication varient largement. Plus on s’éloigne du noyau du pouvoir, moins l’intérêt est grand (changeant à la fois en intensité et en nature) et plus l’assentiment devient un enjeu - la police (comme l’a encore récemment rappelé Alain Soral) étant le point nodal de cette structure.

      Nous non plus ne lâcherons jamais.


  • #2628536
    le 29/12/2020 par Robert
    Covid-19 – Preuves de fraude mondiale

    Il n’y a donc eu aucune surmortalité dans le monde cette année : les 10 ou 30 000 morts habituels en France de la grippe saisonnière ont disparu par MAGIE . Mais ils ont été compensés par l’apparition également MAGIQUE des 30 000 morts de l’imaginaire "covid" . Prestidigitation, tour de passe passe, on est au music hall, et on est aussi crédules que des enfants au théâtre de Guignol .


  • #2628544
    le 29/12/2020 par Covidramatique !
    Covid-19 – Preuves de fraude mondiale

    « Covid-19 – Preuves de fraude mondiale ou le plus grand crime insidieux contre l’humanité. »

    Kahlilah Mitchell infirmière parle de ces symptômes après le vaccin de Satan et elle n’est pas la seule... Son témoignage ici

    Espérons à présent et rapidement un procès Nuremberg inversé menant à des condamnations à la peine de mort par peloton d’exécution !

    Qu’on se le dise, il y a comme un arrière-goût de pisse après 45.

     

  • #2628555
    le 29/12/2020 par Cléon
    Covid-19 – Preuves de fraude mondiale

    Je suis totalement profane en science mais depuis le début j’ai le sentiment qu’il y a pas de virus. Que la narration mediatico-politique suffit.

    Par contre, si quelqu’un est calé, je me demande comment le Pr Montagnier a pu affirmer que le Covid contenait des séquences du VIH s’il n’a jamais été isolé ?

    Merci d’avance.


  • #2628573

    D’accord,
    Mais quid des nombreux gens qui ont perdu le goût ou l’odorat, de ceux qui ont fini en réa ou sont décédés alors que relativement jeunes et en bonnes santé préalable ?

     

    • #2628620
      le 29/12/2020 par sered
      Covid-19 – Preuves de fraude mondiale

      Je n’ai pas toutes les informations dans ma poche mais celles que j’ai c’est que la moyenne d’âge des morts de ce virus est au dessus de l’espérance de vie, ce qui n’est pas très concordant avec "jeune et bonne santé"


    • #2628657
      le 29/12/2020 par Xebeche
      Covid-19 – Preuves de fraude mondiale

      "Et en bonne santé préalable" : Les carences en vitamine D et C sont-elles visibles ? Quid des impacts de la malbouffe sur l’intestin qui semble être à la base de notre immunité ? Qui évite les antibiotiques pour préserver sa flore intestinale ou bien en prend soin en s’alimentant avec des fromages au lait cru par exemple ?
      Ce que nous apprend ce virus c’est que le peuple de France est en bien mauvaise santé factuellement surtout lorsque les individus hospitalisés sont jeunes et qu’ils trinquent sévèrement, non ?

      XB


    • #2628661
      le 29/12/2020 par louis
      Covid-19 – Preuves de fraude mondiale

      Essayez de comprendre que oui, ce virus existe et qu’il est banal ; mais que oui, il est instrumentalisé à des fins ’’politiques’’ comme les vrais chiffres sanitaires le démontrent. Vous faut-il un dessin pour imager l’interdiction de soins précoces, la propagande de dramatisation, les attaques insensées contre les contradicteurs pertinents hautement qualifiés, les interventions de soi-disant experts corrompus ? Comment faut-il le dire ? Depuis quand un couvre-feu ou une attestation dérogatoire sont-ils des mesures sanitaires, depuis quand confine-t-on des personnes qui ne sont pas malades, et pourquoi ? Depuis quand fabrique-t-on des malades qui s’ignorent eux-mêmes par amplification abusive de tests ? Comment guérir une maladie en interdisant des soins et en surutilisant la police ? Faut-il vraiment toujours tout expliquer ?


    • #2628712
      le 29/12/2020 par Jean de tramecourt
      Covid-19 – Preuves de fraude mondiale

      @Louis
      votre commentaire regroupe les points essentiels auxquels j’adhère .


    • #2628726
      le 29/12/2020 par antivax
      Covid-19 – Preuves de fraude mondiale

      Ce qu’il me semble comprendre c’est qu’on a refusé de les soigner.

      Quand le virus est dans la gorge, au stade "mauvaise grippe", il suffit de traiter à la chloroquine par exemple.

      Mais si la chloroquine est interdite, le mal n’est pas traité et le virus descend de la gorge aux poumons, l’état grippal devient un état pulmonaire critique.

      Comme on a mis cet état sur le compte d’un "virus mortel" qu’on ne peut pas soigner, possible que les médecins n’aient pas pensé à identifier ce mal à d’autres maladies pulmonaires déjà existantes et qu’ils aient accepté avec fatalité la propagande ?

      Donc 1) on a refusé de soigner à temps et on a administré ensuite des médicaments contre-indiqués (Remdésivir, Rivotril), 2) les autres personnes qui n’ont pas reçu ces médicaments mais néanmoins décédées de ce "coronavirus" sont en fait mortes d’autre chose, d’un cancer etc. Dans ce cas, on a donc menti sur la cause du décès.

      C’est exactement la même histoire que pour le SIDA : on vous dit que vous avez le SIDA, on vous prescrit alors une sorte de chimiothérapie, et ce sont en fait les médicaments prescrits qui vont tellement affaiblir votre système immunitaire, que votre corps va développer n’importe quelle maladie puisqu’il ne peut plus se défendre. Jusqu’à en mourir. Et en cause de décès, on mettra "SIDA".

      Il apparaît comme point commun dans le cas de ce "coronavirus" comme dans celui du "SIDA" que ce sont les poumons qui sont les premiers touchés, probablement parce que ce ne sont pas des organes complexes munis de défenses immunitaires, ce sont juste de "grosses éponges" qui je crois ne possèdent pas de nerfs. C’est pourquoi dans le cas du cancer des poumons par exemple, on découvre la tumeur trop tardivement parce que celle-ci n’occasionnait pas de douleur.
      Par contre dans le cas d’une gêne respiratoire, quand tout l’appareil est touché, c’est tangible, et la douleur vient s’ajouter j’imagine, quand le mal se développe au-delà de la cage thoracique et de la plèvre.

      Je vous rappelle au passage que certaines personnes (dont Thierry Casasnovas) ont guéri d’un cancer qu’on leur prédisait fatal, alors qu’il leur a suffit d’arrêter la chimio et de faire le plein d’éléments vitalisants (vitamines etc.) pour que leur corps se régénère !...

      Mais tout ça pose une question : s’ils ont laissé ou aidé les gens (à) mourir, est-ce que ce vaccin n’est pas là pour pousser ceux qui ne sont pas encore malades vers la sortie ?


    • #2628878
      le 29/12/2020 par De Bonald
      Covid-19 – Preuves de fraude mondiale

      Que les médicaments eux-mêmes provoquaient la dégénérescence et la mort des gens étiquetés porteurs du VIH ? Je n’y crois pas une seconde ! Il ne faut pas exagérer quand même ! Beaucoup de gens sont morts du sida quand il n’y avait encore AUCUN traitement contre le sida et donc qu’ils n’en prenaient aucun..


  • #2628579
    le 29/12/2020 par mistermoon
    Covid-19 – Preuves de fraude mondiale

    Une démonstration de plus au milieu de cet océan de mensonges que ce virus est une escroquerie.
    Je crains malheureusement que se ne soit qu’une bouteille jetée à la mer tant le rapport de force avec l’ennemi est inégal.
    Mais bon ; tant qu’il y de la vie.....
    Je pense que le vaccin ARN aque21 vas faire beaucoup de dégâts ; peut être pas dans un premier temps , pour tromper un peu plus la populasse (ai confiance ! crois en moi ! ), mais plus tard quand le citoyen de base sera convaincu qu’il faut vacciner à fond ,dénoncer le récalcitrant ( le méchant complotiste d’extrême droite ).
    Je redoute que les prochaines variantes du virus sorties des usines ( buzin lévy )soient réellement meurtriers.


  • #2628582
    le 29/12/2020 par Hugo L
    Covid-19 – Preuves de fraude mondiale

    Bonjour,

    À propos des amorces pcr. Je compte apporter ma petite contribution.

    J’ai conduit et conçu des essais pcr en temps réel (rt-pcr) dans mon ancienne vie professionelle. Pour qu’une amplification exponentielle du matériel génétique se produise et que celui-ci devienne détectable par fluorescence il faut en effet que la séquence d’ADN visée posséde des fragments compatibles avec les deux amorces (avant et arrière ou 5’ et 3’). Sans aller dans le détail de la méthode, le nombre de séquences d’ADN visées, théoriquement, suivra la fonction suivante : Nb.séquence.ADN(cycle) = Nb.séquence.ADN.initial×2^cycle (relation de type exponentielle). Dans le cas où seul une amorce est compatible avec une sequence de gène autre que celle visée (chromosome humain, ADN bactérien par exemple), la relation est grosso modo : Nb.de.séquence.ADN(cycle) = Nb.de.séquence.ADN.initial×(cycle +1) (relation du type linéaire). La mise en relation des deux courbes (sur un chiffrier typique) montrent rapidement que la relation linéaire ne représente pas plus qu’un bruit de fond.

    Cordialement,

    Force et honneur.
    Qc

     

    • #2628625
      le 29/12/2020 par Patrick
      Covid-19 – Preuves de fraude mondiale

      Nb.séquence.ADN.initial×2^cycle

      Cycles Résultat
      20---------------------1 048 576
      25-------------------33 554 432
      30---------------1 073 741 824
      35-------------34 359 738 368
      40---------1 099 511 627 776
      45--------35 184 372 088 832
      50----1 125 899 906 842 624


  • #2628605
    le 29/12/2020 par Patrick
    Covid-19 – Preuves de fraude mondiale

    Bon apparemment toute cette mascarade c’est du bidon, mais on se prépare quand même pour la 3 ème vague et le 3 ème con-finement, qui ne devrait plus tarder.
    Et surtout on prépare ses fesses pour le merveilleux vaccin qui va tous nous sauver.

    Alors heureux les Français ?


  • #2628616
    le 29/12/2020 par Faut voir
    Covid-19 – Preuves de fraude mondiale

    Voici une synthèse sur l’escroquerie

    https://odysee.com/@olivierprobst:8...


  • #2628619

    Doté du système immunitaire qui lui permet de survivre aux attaques virales, microbiennes, micro organiques permanentes qu’il a à affronter, le bipède emmène en permanence des traces de cette lutte physiologique. Une attaque qui prend provisoirement ou définitivement le dessus sur l’organisme du bipède infecté, déclenche des symptômes connus qui déterminent l’état maladif. Dès lors, des remèdes médicaux peuvent être mis en œuvre pour pallier une insuffisance de l’organisme ou hâter sa guérison. Cela signifie que le bipède est constamment en lutte et constamment ’’malade’’ à bas bruit. Extraire de ce bruit de fond permanent des ’’preuves’’ de contamination a toutes fins utiles autre que sanitaires est aisé et si cela transforme un bipède asymptomatique socialement/politiquement révolté en ’’malade’’, pour en faire un prisonnier coupable ; c’est un excellent moyen de juguler une insurrection ; à condition de ne tenir aucun compte des arguments médicaux qui entrent en contradiction avec le discours officiel et d’interdire les soins classiques connus. Il ne se passe rien d’autre. Réveillez-vous et sortez du déni. Vous êtes juste victime d’un coup d’état, dirigé par des sociopathes transnationaux qui ont noyauté et instrumentalisé votre appareil administratif. Ils agissent sous vos yeux.


  • #2628649
    le 29/12/2020 par Adolfo Stalini
    Covid-19 – Preuves de fraude mondiale

    Il y a quand même beaucoup de fautes d’orthographe et de français dans les commentaires. Et ça, c’est plus facile à vérifier que l’existence réelle du virus... En général j’ai tendance à privilégier la bêtise et l’incompétence par rapport à la malignité et à la volonté de nuire. Plus le temps passe, plus cette histoire de virus devient inextricable. L’avidité des grands laboratoires type Gilead (un nom tiré de l’ancien testament) vient se superposer à l’angoisse des dirigeants du monde entier face à un virus issu de manipulations génétiques, d’après ce qui se dit ça et là. L’incompétence scientifique de nos dirigeants ajoutée à la trouille de l’inconnu et à l’avidité de Big Pharma suffisent selon moi à expliquer toute l’affaire sans qu’il soit nécessaire d’avoir recours à l’hypothèse d’une conjuration mondiale. Les hypothèses banales présentent l’immense avantage d’avoir les statistiques de leur côté...

     

    • #2628758

      Assez d’accord avec votre point de vue.
      On cherche parfois a expliquer de manière simpliste des événements dont les causes sont multiples et complexes. De plus, ils sont souvent liés à une conjonction de facteurs non liés entre eux.
      Mais il est plus croustillant d’y voir une conjuration ou un grand complot...


    • #2628801
      le 29/12/2020 par Bon sang mais c’est bien sûr
      Covid-19 – Preuves de fraude mondiale

      expliquer toute l’affaire sans qu’il soit nécessaire d’avoir recours à l’hypothèse d’une conjuration mondiale.
      c’est ben vrai ca, comme disait la Mère Denis (Coluche). Ya qu’a voir les actes et déclarations de Bill Gates et son génocide prémédité à coup de milliards de dollars, de Klaus Schwab grand prêtre sataniste et son grand reset, Merkel, Trudeau, Macron, et tutti quanti gouvernements occidentaux, pantins appliquant à la lettre le plan philanthropique, aspirant à nous piquer, pucer, numériser, OGM’iser et décimer pour 3/4 d’entre nous par pure humanité et altruisme. Des bisous partout hou hou...


    • #2629216
      le 29/12/2020 par De Bonald
      Covid-19 – Preuves de fraude mondiale

      Il suffit d’avoir un 6éme sens ( et ça en général c’est la spiritualité qui le confére) et de regarder la mise en scène étatique et médiatique devant nous pour voir que tout cela n’est pas clair du tout. Sans compter leurs contradictions sans nombre et incessantes. Quand il y a quelque chose de si bizarre, c’est qu’il y a un loup comme dirait Martine.


  • #2628651
    le 29/12/2020 par anonyme
    Covid-19 – Preuves de fraude mondiale

    N’oubliez pas : vous n’êtes que des téléspectateurs.


  • #2628673
    le 29/12/2020 par charles
    Covid-19 – Preuves de fraude mondiale

    Il fallait oser faire des centaines de millions d’habitants d’un système, de coupables insurgés potentiels, et les soumettre en ratissant large, à des mesures très polyvalentes de contre insurrection sous prétexte sanitaire. C’est indiscutablement très impressionnant quoique plutôt rudimentaire, ce qui explique le niveau de violence. Tout cela aura une très longue queue.


  • #2628697
    le 29/12/2020 par Docteur Schweitzer
    Covid-19 – Preuves de fraude mondiale

    Si le "covid-19" n’existe pas, il y a quoi dans ces vaccins ? et comment justifier tous ces morts et ceux à venir ?
    Si la cause n’est pas virale, elle est donc intentionnelle ! On appelle ça un génocide.
    Comme pour le SIDA, dont l’intention, cachée derrière une sorte de fatalité médicale admise de tous, n’a pas non plus été jugée, et le mythe perdure là aussi...

     

    • #2628733
      le 29/12/2020 par Je réfléchis 2 secondes
      Covid-19 – Preuves de fraude mondiale

      Pour l’avoir vu, ils bourrent les gens d’antibiotiques à hautes doses bourrés de nanoparticules dangereuses, ils anémient leurs patients avec une nourriture catastrophique sachant qu’un déficit important en fer et en B12 conduit à la mort. Ils gavent les gens avec des compléments hyper protéines bourrés de saloperies cancérigènes et acidifiantes. Tout cela conduit à la mort mais vous ne le verrez pas (sauf un médecin digne de ce nom) parque à chaque symptôme nouveau qui peut vous alerter ils rajoutent un nouveau médicament pour le camoufler.


    • #2628821
      le 29/12/2020 par Une nuit au sommet du mont Eiger
      Covid-19 – Preuves de fraude mondiale

      On entend déclarer ça et là, que les hôpitaux, et certains médecins généralistes, ont eu jusqu’à présent pour mission de répertorier un décès dans la liste Covid, quelle que soit la nature de la pathologie dont il est issu, et c’est ce qui expliquerait que la liste des décès dus à la Covid est surévaluée.


  • #2628699

    C’est un argument que je n’utilise pas car c’est beaucoup trop technique pour en parler dans une conversation normale.


  • #2628706

    La responsable scientifique de l’OMS vient de déclarer qu’il n’y a aucune preuve que les vaccins "anti Covid" soient efficaces . Elle a raison de protéger ses arrières...

     

  • #2628707
    le 29/12/2020 par le pépère
    Covid-19 – Preuves de fraude mondiale

    une seule inconnue : qui a écrit cette étude très détaillée ?


  • #2628714

    Covid = coquille vide !

     

  • #2628718

    La base de tout ,que se soit au niveau médical comme au niveau journalistique ,c’est la corruption .Ça c’est un fléau qui est ravageur ,et c’est certainement le plus terrifiant .


  • #2628721
    le 29/12/2020 par Franc
    Covid-19 – Preuves de fraude mondiale

    Ce qui est certain, c’est qu’il n’y a pas de trace de covid meurtrier et encore moins d’épidémie.
    Tout cela n’est qu’une énorme fumisterie !
    Il suffit d’observer nos journées au quotidien, et de constater qu’il se passe rien, a part des gens qui se promènent avec des masques et toute cette peur ambiante fabriquée, on voit qu’il n’y a rien, tout se passe comme d’habitude. Il n’y pas plus de malades et de morts qu’avant.
    Je ne connaît personne qui a été malade du "covid", ou mort, ni chez mes collègues de boulot.
    C’est juste une epidemie de tests et de gens sains !
    Tout le monde peut observer ça autour de soi !

     

    • #2628756
      le 29/12/2020 par Jordan
      Covid-19 – Preuves de fraude mondiale

      Et bien moi je connais au moins 4 personnes différentes qui ont eu le covide, et toutes admettent sans le dire comme tel, qu’elles ont eu un gros coup de fatigue asser long... Une grippe en somme.


    • #2628767
      le 29/12/2020 par dur dur
      Covid-19 – Preuves de fraude mondiale

      Par contre les plus soumis, donc les plus masqués, salariés en particulier, n’ont pas l’air très sains, comme s’ils couvaient un rhume, dés qu’ils ne sont plus de la toute première jeunesse (passé trente ans).
      En février 2020, quand ils allaient voir le médecin avec fièvre et maux de tête, celui-ci prescrivait du doliprane. Jamais d’antibiotiques.
      Cet article est si technique que j’ai laissé tomber, attendant l’avis des médecins de E&R.
      Malgré cela, il semble évident que cette épidémie est un génocide planifié par des nantis et diminués physiques (vieux ou tarés), qui prétendent traiter l’humanité comme ils traitent les locataires indésirables de leurs complexes immobiliers, ou les propriétaires de terrains qu’ils convoitent : allez ouste !
      La nouveauté, c’est la totale hypocrisie du projet.


  • #2628727
    le 29/12/2020 par De Bonald
    Covid-19 – Preuves de fraude mondiale

    Mouais.......je connais des gens que je connaissais trés bien et qui n’étaient visiblement pas destinés à mourir avant quelques décennies et qui ont été emportés subitement en trés peu de temps avec tout le processus décrit du Covid donc il y a bien quelque chose quand même......

     

    • #2629007
      le 29/12/2020 par Surimi
      Covid-19 – Preuves de fraude mondiale

      Un de mes proches âgé présente brutalement quelques symptômes covidiens.
      Ce qui m’inquiète, c’est la disponibilité du traitement Didier Raoult car beaucoup de médecins sont des Blachiers, je le crains. Et malgré cela d’ailleurs, la surmortalité générale semble très faible.


  • #2628734

    Il est clair qu’il existe bel et bien un virus ou autre qui provoque des symptômes. cela dit il est instrumentalisé à des fins politiques et économiques. Après allez donc expliquer à la masse que ceci est une mascarade... va falloir être béton armé dans les arguments et les preuves car c’est très très loin d’être gagné !! même les plus méfiants auraient vraiment du mal à croire qu’ils se sont faits baiser en beauté depuis 1an ! C’est tellement « international » que c’est suspect mais cela lui donne aussi une forte crédibilité. nous n’auront jamais la vérité là dessus, ou ce seront les dissidents de 2100 qui feront le travail mais il sera trop tard !!

     

  • #2628742

    On peut, sans être spécialiste de quoi que ce soit et en ayant simplement du bon sens, comprendre que la "pandémie" est indiscutablement une "storytelling", un conte, inventée avec beaucoup de préparation stratégique en amont.

    Le SIDA avait déjà été une sorte de ballon d’essai, assez concluant à l’époque puisque ce supposé "virus sida" n’a en réalité jamais été isolé non plus malgré les affirmations. Montagnier a attendu d’être retraité et d’aller travailler hors de France (en Chine précisément) pour faire comprendre ici et là selon les entretiens qu’il accordait qu’aucun scientifique ne pouvait sérieusement affirmer avoir isolé un quelconque virus du sida.

    Mais la machine avait déjà enclenché toute les manœuvres du grand marché de la chimie et l’on ressortit le fameux AZT (vieille molécule particulièrement toxique qui avait été vendue pour les personnes âgées - rep. "La Maffia médicale" de Ghuylaine Lanctôt qui eut d’ailleurs beaucoup d’ennuis suite à son travail, ses publications et ses prises de position pour démasquer le sida).

    Le Vivant est d’une telle complexité qu’en dépit des grands discours, souvent obscures pour le commun, la vérité est qu’aucun "expert" en virologie, infectologie et microbiologie n’est en capacité d’affirmer quoi que ce soit quant au fonctionnement définitif d’une cellule, d’un génome animal ou humain. Les adaptations et recombinaisons sont permanentes et ce phénomène très complexes échappe depuis toujours aux "savants".

    Les enjeux d’argent dans le système du monde moderne sont tels qu’il est devenu impératif pour tout chercheur d’affirmer avoir trouvé tel ou tel petit bout de cet insondable puzzle organique vivant. Cela déclenche forcément d’interminables controverses propices à de plus en plus de dérives indémontrables en vrai.

    Le domaine de la santé, pavé de supposées bonnes intentions, a inventé une malade dite SIDA et aujourd’hui une autre dite COVID19. Demain, il ne fait pas de doute qu’ils en inventeront bien d’autres.

    Cette approche de la "santé" correspond bien au bio pouvoir, déjà dénoncé par Foucault et d’autres intellectuels dès les années 75. Nous y sommes et au nom du "protégeons nous les uns les autres", formule quasi biblique, le monde post moderne bascule, par la grâce perverse d’une poignée de fous, dans un effectif "nouveau monde" où la Santé Globale est l’arme absolue d’aliénation sans limite.

     

    • #2628862
      le 29/12/2020 par De Bonald
      Covid-19 – Preuves de fraude mondiale

      Oui mais il y a de toutes façons quand même quelque chose qui provoque la dégénérescence des gens dont on dit qu’ils ont le SIDA ou Covid ou autre. Peu importe que le virus ait été isolé, qu’il existe ou pas......J’ai connu des gens que j’ai vu soudainement plonger vers 1990 à cause du sida et ils en sont morts. A 25 ans. Et pas homosexuels non plus. Et quelques filles.


    • #2628866
      le 29/12/2020 par De Bonald
      Covid-19 – Preuves de fraude mondiale

      Ceci étant, ils nous avaient déjà quelque peu isolés les un des autres avec le préservatif, là on est visiblement passés à un stade plus général avec la distanciation sociale et le masque, tout cela à durée indéterminée.


  • #2628746
    le 29/12/2020 par Duguesclin
    Covid-19 – Preuves de fraude mondiale

    Bonjour,
    Je me permets d’apporter mon propre témoignage :
    Jeune homme de 23 ans, j’ai eu, début octobre, une maladie qui a provoqué la perte du goût pendant 4 jours et de l’odorat que je n’ai toujours pas retrouvé totalement à ce jour. Ça s’est manifesté le premier jour par un mal de tête (chose que je n’avais jamais eu jusqu’à alors) et de la fièvre (38,5). Puis le lendemain un mal de gorge et de la toux pendant 2-3 jours. J’ai réalisé un test PCR m’indiquant être positif au Coronavirus. L’ARS m’a ensuite appelé dans la journée pour savoir qui j’avais fréquenté dernièrement et pour prendre contact avec ces personnes. Je n’ai eu aucune consigne particulière, l’agence n’avait pas l’air du tout inquiète. Je n’ai transmis ma maladie à personne alors que je vivais chez ma mère et que j’ai vu ma copine (ou du moins, aucune n’a manifesté de symptômes).
    CONCLUSION => Il semble que j’ai effectivement eu une maladie dont les symptômes sont identiques à ceux associés au coronavirus et que cette maladie existe bel et bien. Je suis actuellement en parfaite santé (mentale et physique).

    Second témoignage : Un ami a eu un test PCR positif mais aucun symptômes et suite à un test avec prise de sang, il apparait qu’il n’a aucune trace de ce virus. Est-ce un faux positif ? Ou alors est-ce que la maladie n’est pas immunisante ?

     

    • #2629034
      le 29/12/2020 par plouf
      Covid-19 – Preuves de fraude mondiale

      Si vous aviez eu cette maladie il y a plus d’un an on aurait tout simplement dit que c’est la grippe. La grippe "normale" (disparue d’ailleurs) provoque (ait) elle aussi la perte de goût et d’odorat.


  • #2628747
    le 29/12/2020 par tristan
    Covid-19 – Preuves de fraude mondiale

    Tout ça pour deux braquages : celui de l’élection us et de l’économie mondiale.
    Et pour mettre sous contrôle l’humanité avant qu’elle ne se retourne contre les malfaisants qui ont le pouvoir par la finance.
    Tout est révélé


  • #2628748
    le 29/12/2020 par petithous
    Covid-19 – Preuves de fraude mondiale

    Je crois que la religion scientifique est comme toutes les religions, elle repose sur des croyances, avec ses églises, ses cathédrales, ses grands prêtres, ses rites, ses anathèmes, ses inquisitions , et ses fidèles dévots soumis, etc ....
    Je pense que c’est une erreur de confondre "vérité scientifique" avec "Vérité".
    Mais le drame de notre époque c’est d’être allé encore plus loin et d’estimer que la "vérité scientifique" est supérieur à la "Vérité" .
    Pour moi le combat "scientifique" est stérile et ne conduira à rien de positif.
    Quoi qu’il en soit de la pandémie, réelle, imaginaire, fabriquée de toute pièces pour des intérêts occultes, la chose la plus importante pour moi, c’est que je reste un homme libre, et qu’il n’appartienne à qui que ce soit de m’imposer sa loi .
    L’humanité n’est pas une ruche, ou l’entité est la ruche elle même, mais chaque être humain est un individu possiblement indépendant est autonome, même si ce n’est plus vrai pour 99% des êtres humains .
    L’humanité entière peut disparaître demain, je vivrais le reste de mes jours sans grands problèmes.
    Je n’ai pas dit que c’était bien, je n’ai pas dit que c’est ce que je souhaite, je dis que c’est possible .
    S’il faut se renier pour vivre, alors autant mourir, car il n’y a rien de pire qu’être un mort vivant !


  • #2628764

    Leroy Redacteur en chef de Causeur, vient de publier qu’il allait se faire vacciner par altruisme. A partir de là, je suis ouvertement contre ce Vaccin. Onfray, Leroy....sont les agents sataniques


  • #2628807
    le 29/12/2020 par Pépé le Moko
    Covid-19 – Preuves de fraude mondiale

    " L’Organisation mondiale de la santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019. "

    L’ "OMS" préconise aussi d’enseigner la branlette à l’école , et notamment dès l’âge de 4 ans !!!


  • #2628810
    le 29/12/2020 par De Bonald
    Covid-19 – Preuves de fraude mondiale

    De toutes façons, leurs chiffres semblent bidons. C’est quoi cette maladie où plus de 80% des gens sont totalement asymptomatiques ? Vous avez déjà connu à titre personnel une grippe sans symptômes ?


  • #2628813
    le 29/12/2020 par carolus
    Covid-19 – Preuves de fraude mondiale

    Des mesures absurdes, contreproductives et aggravantes sur le plan ’’sanitaire’’ ; qui retrouvent toute leur pertinence vues au travers du prisme stratégique contre insurrectionnel d’un putsch terroriste international. Le tout servi par le déni de réalité des victimes elles-mêmes. Un grand moment.


  • #2628831
    le 29/12/2020 par Patriote
    Covid-19 – Preuves de fraude mondiale

    Et si les virus agents pathogènes n’existaient tout simplement pas ?

    Et s’ils n’étaient, dans le meilleur des cas, que le résultat de bactéries réellement en cause voire que le produit de l’organisme défaillant lui même, à la manière d’un prion ?

    Plus c’est gros plus ça passe. Ayant quelques connaissances élémentaires en physique on s’aperçoit de façon très nette que les histoires officielles du voyage sur la lune, du WWC et de tant d’autres, sont absurdes avec des ficelles grossières. Cela ne m’étonnerait guère que celle des virus soit faite du même plastique...

     

    • #2630001
      le 30/12/2020 par Anti-virologues
      Covid-19 – Preuves de fraude mondiale

      Vous ne croyez pas si bien dire cher ami... !

      Il existe une petite troupe de dissidents qui poursuit sans financement ou presque la thèse selon laquelle nous devons tout rééexpliquer, face à ce paradigme "viromane" pour qui toutes les maladies sont virales et contagieuses, quand elles ne sont pas bactériennes.

      À commencer par le magique VIH, cause supposée du SIDA qui regroupe... des maladies déjà connues !

      Les dissidents s’étaient récemment retrouvés pour une conférence internationale (mais confidentielle) dans la commune de Pont-du-Gard, intitulée "Remise en cause des paradigmes viraux cupides".
      On y trouvait Étienne de Harven, mort l’année dernière, et que E&R avait relayé il y a 10 ans pour le SIDA (45 minutes qui valent le coup...).
      On y trouvait le Canadien David Crowe, mort cette année d’un cancer fulgurant, quelques semaines après avoir démonté point par point (sur 90 pages) l’absurdité de la thèse de la contagion (original en anglais).
      Il animait un podcast, lui aussi confidentiel, nommé The Infectious Myth, où il interviewait des spécialistes généralement dissidents permettant d’expliquer les maladies sans le concept de virus et de contagion.

      S’il existe des francophones faisant partie de ce groupe, qu’ils se fassent connaître ci-dessous, je les cherche aussi...

      P.S. : je ne comprends vraiment pas la censure... ce ne sont que des sites amis...


  • #2628877
    le 29/12/2020 par Reflex-sion
    Covid-19 – Preuves de fraude mondiale

    300 milliards "d’emprunts" et pas un lit d’hôpital supplémentaire pour cette année 2020.Fin de l’analyse.


  • #2628884
    le 29/12/2020 par Robespierre
    Covid-19 – Preuves de fraude mondiale

    Une fois éloigné du bruit médiatique, chacun sait dans son for intérieur ce qu’est une épidémie grave. Je ne suis pas médecin, mais je ne crois pas qu’il existe des porteurs « asymptomatiques » de la peste, du typhus, ou de la lèpre. En cas de guerre bactériologique, on comprend qu’il faille prendre des mesures extrêmes. Mais que penserait-on d’une arme bactériologique qui épargne environ 199 personnes sur 200, voire 399 sur 400 ? Tout cela n’est pas sérieux.

    Dans mon cercle très élargi de connaissances, il m’est revenu deux témoignages à propos de cas ayant nécessité une hospitalisation. Effectivement les malades ont été secoués : assistance respiratoire. Les deux sont vivants. Et les deux ont aux alentours de soixante-dix ans.

    N’oublions pas qu’au tout départ de ce cirque il s’agissait d’éviter l’engorgement du système hospitalier littéralement saccagé par au moins deux décennies de rapines sociales-démocrates. La bande de bras-cassés qui est censée gouvernée la France a été trop heureuse de trouver une occasion de briller à peu de frais et de détourner l’attention de ses impérities.

    « Nous sommes en guerre »... Il ne faut avoir aucune conscience de ce qu’est la guerre pour proférer une énormité de cette farine. À moins que l’on ne veuille focaliser l’attention sur un doigt plutôt que sur la lune en se donnant le beau rôle. Mais les escrocs auront beau faire, un jour où l’autre après l’embâcle artificielle vient la débâcle. Cela va déjà faire un an qu’on nous rebat les oreilles avec la vie mystérieuse des pangolins, des chauve-souris et du virus-mystère. Le public se lasse.


  • #2628912
    le 29/12/2020 par Jay Duplond-danlèle
    Covid-19 – Preuves de fraude mondiale

    "Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal."
    Merci pour la rigolade...c’est la fille violée qui porte plainte contre son violeur devant un juge pervers sexuel.


  • #2628926
    le 29/12/2020 par Mes Gauloises marseillaises aussi !
    Covid-19 – Preuves de fraude mondiale

    Ah enfin ! Ça fait des mois que j’essaye de vous expliquer qu’ils vous baisent des 2 côtés...
    Le débat chloroquine vs vaccin est de la pure subversion. Les masques tombent, mêmes les plus "franchouillards"...


  • #2629004

    le’’covid’’ est la contre-mesure des politiques monétaires expansives (...infinies). Évidemment qu’il s’agit d’une fraude...


  • #2629031
    le 29/12/2020 par De Bonald
    Covid-19 – Preuves de fraude mondiale

    La grande question sera donc : vaut-il mieux ne plus pouvoir aller au théâtre, cinéma, restaurant etc….et voyager parce qu’on en est interdits car pas vaccinés ou parce qu’on ne peut plus car malades ( à moyen ou long terme) du vaccin ?


  • #2629070
    le 29/12/2020 par Stéphane
    Covid-19 – Preuves de fraude mondiale

    Un article très intéressant qui ouvre à de nombreux sujets polémiques.
    D’une part (à mon sens) il y a querelle sur la définition à employer à propos de "bactéries" et de "virus", dans l’avenir comment notre compréhension du monde du vivant, du corps, du microscopique pourra-t-elle continuer avec des observations puis des commentaires qui, suivant les cas, arrivent à se contredire les unes et les autres. Il y a à cet endroit matière a de passionants débats scientifiques(sans le mainstream de trahison).
    Pour l’exemple, de nombreuses pointures dans leurs domaines, dont il me semble que l’on peut leur faire crédit de l’honnêteté (sur leur travail et pas de corruption des labos) ce qui est le cas de Raoult, Perronne, Montagnier, Fourtillan, Tal Schaller...., je constate que ces spécialistes ne sont pas d’accord entre eux, parfois leurs avis sont complémentaires et à d’autres endroits divergents. Présence ou non du virus, viabilité des tests, modèle pasteurien, modèle de Beschamps (microzyma), modèle de somatisation des maladies..... A l’instar de l’astrophysique, la non concordance des modèles théoriques, des observations et des corrélations indiquent pour ma part que les modèles théoriques doivent être sérieusement retravaillés.
    Ce qui est frappant, c’est qu’avec le narratif imposé du "système" nous ne possédons pas notre histoire ( il y a bien sûr certaines séquences d’évènements qui sont prouvables) et retracer les évènements sur un plan historique afin d’identifier les séquences des évènements "covid", est difficile à conceptualiser. En l’absence des éléments véritables de notre histoire, fût elle récente pour le cas covid, nous ne pouvons dès lors concevoir collectivement des thèses plus adaptées afin d’étendre notre compréhension, source de solutions et d’apaisement. La toute première base de réflexion.
    Pour les tests pcr, il y a trop d’éléments factuels aujourd’hui pour affirmer qu’ils soient fiables.

    Pour la partie "Y a t il un virus". Il me semble là aussi que le doute est source de questionnement et chez mainstream les insultes fusent, toute référence à cette question est considérée en tant que négationnisme du virus. Il y a bien un "quelque chose" et la domination de l’élite en France est de faire passer cet invisible à l’oeil nu comme le mal absolu. Nous pouvons être certain que ce qu’il y a n’est pas très important en comparaison aux autres catastrophes de l’humanité. La peur de l’inconnu est une vieille ficelle pour manipuler tant de personnes.


  • #2629105
    le 29/12/2020 par sixties
    Covid-19 – Preuves de fraude mondiale

    Article extrêmement complexe et documenté pour des profanes. Il faudrait savoir ce que le Dr Fouché en pense . Par contre, ce qui est certain, c’est que le développement et les conclusions s’harmonisent parfaitement avec le great reset !


  • #2629158
    le 29/12/2020 par Paul82
    Covid-19 – Preuves de fraude mondiale

    Si ces informations sont exactes, c’est absolument explosif, et ce de toute l’année 2020 ! Je sais déjà qu’il n’y pas de pandémie (l’OMS a changé la définition peu de temps avant la 1ere vague, comme par hasard). Mais en plus ce virus n’existe pas, ou qu’il n’est pas du tout responsable de ces symptômes.... Les conséquences sont incalculables !


  • #2629384
    le 30/12/2020 par Okaren
    Covid-19 – Preuves de fraude mondiale

    Désolé de m’en prendre à lui, mais dans son dernier livre Pr Raoult préconise la vaccination contre la grippe en l’inoculant aux enfants car :
    - ce sont les principaux vecteurs de la maladie,
    - ils sont les plus réceptifs aux vaccins,
    - ils meurent également de la grippe.
    L’exemple qu’il cite est celui de l’arrêt de la vaccination dès l’entrée à l’école au Japon, qu’il corrèle avec l’accroissement des cas de grippe chez les sujets âgés. Il se focalise sur une donnée (contamination à une maladie) sans étudier l’impact sanitaire (effets des centaines de produits chimiques contenus dans les vaccins sur la santé).
    C’est d’autant plus mal venu qu’au pays du Soleil levant on recense un nombre record de centenaires en raison de leur bonne hygiène de vie, et pas à la médecine occidentale. Et ça n’est pas dans les revues scientifiques (Lancet et compagnie) que notre cher Professeur trouvera des études allant à l’encontre de la pharmacologie.

    De plus, il a pris partie dans une interview pour le vaccin contre le papillomavirus. Bien qu’il n’ait pas eu l’outrecuidance de s’en prendre à Gérard et Nicole Délépine, il fait partie de ces médecins qui penchent largement vers une médecine allopathique.

    Enfin, bien que Raoult me soit sympathique à plusieurs égards, il me semble regrettable qu’il se focalise sur l’HCQ alors qu’il existe d’autres traitements comme l’ivermectine, l’artemisia, le plasma etc. Et qu’à part le zinc, il ne parle pas des vitamines C ou D, ou tout autre nutriment permettant de passer outre un grand nombre de maladies grâce à son seul système immunitaire.

    Question d’expert que beaucoup ici se posent : si le virus responsable du Covid19 n’a jamais été isolé, ce qui rend d’ailleurs les tests PCR totalement bidon, comment Raoult, et maintenant d’autres labos partout dans le monde, arrivent à séquencer de nouvelles souches ?

     

    • #2631981
      le 02/01/2021 par paramesh
      Covid-19 – Preuves de fraude mondiale

      une souche chez Raoult c’est simplement un prélèvement sur un malade dont on fait une analyse génétique et une nouvelle souche est une souche qui présente des transformations génétiques par rapport au génome transmis par l’équipe chinoise qui est sensée avoir isolé et séquencé le virus. on peut tout nier mais il y a un truc de sûr c’est qu’il y a eu une épidémie de pneumonie cette année, avec des symptômes très particuliers qui donnent à penser que c’est une nouvelle maladie et qu’il faut la soigner. c’est pour ça que Raoult sur ce coup là a fait son boulot de médecin, il a avant tout cherché à rassurer et à soigner. Après, jusqu’à tel point il est honnête intellectuellement ? c’est vrai que croire à un génome sans avoir isolé lui même le virus puisque cela semble un putain de problème et en prenant pour argent comptant le génome chinois issu d’une souche purifiée et isolée dont on n’a jamais vu la couleur.
      Et puis tu as raison, c’est un pasteurien et sur les vaccins il n’était pas très regardant, loin de là. mais il est contre celui du covid donc la dessus il s’est racheté. pour le reste c’est une huile du système, une grande gueule oui mais certainement pas un rebelle. mais l’important pour nous c’est que ce soit un bon médecin. une profession qu’il vaut mieux éviter de fréquenter.


  • #2629480

    Pourtant, les professeurs Raoult, Perronne, Montagnier et Foucher n’ont jamais nié l’existance du virus et n’ont jamais même sous-entendu qu’il n’avait pas été isolé. Au contraire ! Pourtant, ce ne sont pas des guignols, ni des menteurs.. Honnêtement, je ne sais pas trop quoi penser de cet article.


  • #2629531
    le 30/12/2020 par UnPseudo
    Covid-19 – Preuves de fraude mondiale

    C’est soi-disant facile de trouver les informations par soi-même pour vérifier comme ils disent, mais en fait pas du tout ????.
    L’article est très alembiqué. Au final, qu’est-ce qu’ils veulent dire ? La seule chose claire c’est que le test n’est pas assez spécifique, mais on ne comprend pas s’ils nient l’existence de la maladie.
    Il y a quand même bien une maladie pulmonaires avec cette perte d’odorat, j’ai pas mal de connaissances qui l’ont eu et ça a fait quelques "ravages" dans la chorale de ma mère, alors que ces gens n’avaient jamais eu de telles maladies auparavant.
    Bref, il existe bien une maladie, est-ce qu’on connaît sa vrai origine et est-ce qu’on evalue bien son incidence ?
    Cette article ne nous éclair pas tant que ça et tout ce qu’il raconte est dur à vérifier comme ce que nous raconte le gouvernement...

     

    • #2629613

      Sérieusement, pourquoi parlez-vous de la perte d’odorat comme s’il s’agissait d’une première...les merdias ont mis en avant les symptômes ’’associés’’ au ’’covid’’ notamment la perte de goût et la perte d’odorat. Peut-être n’avez-vous jamais eu la grippe ? mais personnellement une simple grippe s’accompagne souvent d’une perte de goût et d’odorat - donc rien d’extraordinaire.

      N’avez-vous pas compris que ces merdias cherchent à faire peur à tout prix ? Ce que je ne comprends pas en revanche, c’est comment se fait-il que tout le monde devient amnésique à ne pas se souvenir des effets d’une simple grippe sur nos sens ? peut-être avez vous la réponse, vous qui vous interrogez.


  • #2632050
    le 02/01/2021 par paramesh
    Covid-19 – Preuves de fraude mondiale

    simple hypothèse,
    les faits :
    1) le laboratoire de Wuhan travaillait pour des labos étrangers ( tout se retrouve sur le net et sourcé) qui n’avaient plus le droit de faire des recherches dangereuses et devenues illégales dans leurs pays et donc le faisaient en Chine où tout est open bar. le boulot est de créer un coronavirus apte à servir d’amorce pour des vaccins de tous types. certains de ces coronavirus de synthèse ont été déposés avec un nom et donc on connait leurs génomes.
    2) un virus de synthèse n’a pas besoin d’être isolé puisqu’il est crée (son génome est recomposé et bidouillé) donc on connait parfaitement son génome puisqu’on l’a crée.
    3)on sait que les coronavirus naturels préfèrent parasiter les animaux plutôt que les hommes et surtout qu’ils sont très peu stables génétiquement.
    hypothèse
    un virus de synthèse s’est échappé du labo.
    On l’a retrouvé sur un marché aux animaux voisin (le pingolin) : la première souche.
    les chinois qui connaissent le nom et le génome de leur virus s’aperçoivent que leur première souche diffère légèrement du génome originel qui s’est échappé, il a donc déjà muté ( or c’est un virus de laboratoire qui doit au contraire rester stable pour être efficace dans un vaccin). ce qui indiquerait que ce virus était en évaluation et n’avait pas encore été breveté (l’argument des partisans de l’origine naturelle du virus). il s’est répandu et a muté sur des animaux (sa cible favorite) c’est pour ça qu’on en a aussi retrouvé sur des humains .
    le génome que nous ont donné les chinois est le génome du premier virus agrémenté de la séquence pingoline ou autre bestiole (la dernière fois qu’il a muté c’est la souche 5 en europe avec la mutation sur les visons danois). les chinois nous ont retransmi le génome légèrement modifié d’un virus qu’ils avaient crée, juste assez modifié pour prétendre que ce n’était pas le même virus mais un virus naturel qui n’avait rien à voir avec leurs expériences.
    Ce qui explique qu’ils soient allé aussi vite avec leurs vaccins, ils y travaillent depuis des années et des années. ce virus ils le connaissent puisqu’ ils l’ont crée. par contre la maladie nouvelle ils ne l’avaient pas prévue
    ils travaillaient sur un virus qui devait être stable pour que les vaccins soient efficaces contre des virus identifiés comme stables. et patatra la bestiole s’échappe et elle mute. du coup le vaccin c’est foutu, c’était prévu pour des maladies connues, pour des virus stables, pas pour un enculeur de pingolins.


Commentaires suivants